View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_low_34 (Length: 239)
Name: NF11309_low_34
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 18649057 - 18649261
Alignment:
| Q |
18 |
tgtatgagttaggattctttcaacannnnnnnnccacatttgttgcgtgtgccttcaaatttcatcagaggaattattttggaagtttggaattggtttg |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18649057 |
tgtatgagttaggattctttcaacattttttttccacatttgttgcgtgtgccttcaaatttcatcagaggaattattttggaagtttggaattggtttg |
18649156 |
T |
 |
| Q |
118 |
atcctggaaaaatcgcctcggatcgcaaggcgatttgctcaggacccaaaattgcaaggtaatttcccataatcgctagaaatggcagagctttttgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18649157 |
atcctggaaaaatcgcctcggatcgcaaggcgatttgctcaggacccaaaatcgcaaggtaatttcccataatcgctagaaatggcagagctttttgaag |
18649256 |
T |
 |
| Q |
218 |
atcac |
222 |
Q |
| |
|
||||| |
|
|
| T |
18649257 |
atcac |
18649261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University