View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_low_38 (Length: 203)
Name: NF11309_low_38
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 4063627 - 4063463
Alignment:
| Q |
18 |
gaagacaaaaaagtggtcaatagttagttatgaaaactttgnnnnnnncaaaaagtgatataatatatttttgaagaataaaaagtgatataattaatat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4063627 |
gaagacaaaaaagtggtcaatagttagttatgaaaactttgtttt---caaaaagtgatataatatatttttgaagaataaaaagtgatataattaatat |
4063531 |
T |
|
| Q |
118 |
ggagaatatgattttggagggacatgaaactaaaaattgtgattggtatttgtgcagggtgcttgatc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4063530 |
ggagaatatgattttggagggacatgaaactaaaaattgtgattggtatttgtgcagggtgcttgatc |
4063463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University