View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_high_21 (Length: 256)
Name: NF1130_high_21
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 47 - 161
Target Start/End: Complemental strand, 34946668 - 34946554
Alignment:
| Q |
47 |
aattacatctaatactctatgaaccgatatttcagattgaaaatgtattacatcgatacatgtgtttattatatttaatcattttgtttattcaaattgt |
146 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946668 |
aattacatctaatactatatgaaccgatatttcagattgaaagtgtattacatcgatacatgtgtttattatatttaatcattttgtttattcaaattgt |
34946569 |
T |
 |
| Q |
147 |
tggaaatcaagtgtg |
161 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34946568 |
tggaaatcaagtgtg |
34946554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University