View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_high_22 (Length: 256)
Name: NF1130_high_22
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 7326975 - 7327201
Alignment:
| Q |
1 |
catcgtcgatgcatttccattgtaatagtatggtgataagttttcatcattttcagctacatccttccttttcatatcgattttcagatcgcacgtaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7326975 |
catcgtcgatgcatttccattgtaatagtatggtgataagttttcatcattttcagctacatccttccttttcatatcgattttcagatcgcatgtaaca |
7327074 |
T |
|
| Q |
101 |
ttagcataaactcgattggcccagtcggcccaattaacatcaatctgcttgcaagggtaagattgtgggtacctaccttcttgagactccacgtagtatg |
200 |
Q |
| |
|
|||| || ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327075 |
ttagtatcaactcgattggcccagttagcccaattaacatcaatttgcttgcaagggtaagattgtgggtacctaccttcttgagactccacgtagtatg |
7327174 |
T |
|
| Q |
201 |
agctttgcgcattggaaatcatagaag |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7327175 |
agctttgcgcattggaaatcatagaag |
7327201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 162
Target Start/End: Complemental strand, 752341 - 752309
Alignment:
| Q |
130 |
ccaattaacatcaatctgcttgcaagggtaaga |
162 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
752341 |
ccaattaccatcaatctgcttgcaagggtaaga |
752309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University