View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_10 (Length: 406)
Name: NF1130_low_10
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 194 - 283
Target Start/End: Complemental strand, 3820105 - 3820016
Alignment:
| Q |
194 |
ttatatgacactttacttgatataaaaacatgtagagtctttggttgccttcaactatgcctcaaaccttcaatatcatagagccaaact |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3820105 |
ttatatgacactttacttgatataaaaacatgtagagtctttggttgcctttaactatgcctcaaaccttcaatatcatagagccaaact |
3820016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 291 - 379
Target Start/End: Complemental strand, 3819633 - 3819545
Alignment:
| Q |
291 |
catagtactccaaatcctatttctcagtatatgtcatttactaatttctataattcttattatcattttggtttgtcacttaccactca |
379 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3819633 |
catagtactccaattcctatttctcagtatatgtcatttactaatttctataattcttattatcattttggtttgtcacttaccactca |
3819545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University