View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_21 (Length: 344)
Name: NF1130_low_21
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 93 - 272
Target Start/End: Complemental strand, 8371860 - 8371681
Alignment:
| Q |
93 |
aatgatgtttgtgtttaaaaataaattaacgtattaaaatggttctggaaaaagaaaagggtgggaatctgtgtttatttgtgtgggagagaatagaaga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
8371860 |
aatgatgtttgtgtttaaaaataaattaacgtattaaaatggttctggaaaaagaaaggggtgggaatctgtgtttatttgtgtggaaaagaatagaaga |
8371761 |
T |
 |
| Q |
193 |
gaatgagactggctgatgaatgctgatgatgatggaaacaagaaaggggtgaagaaataaaattgatggaatggggataa |
272 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8371760 |
gaatgagaccggctgatgaatgatgatgatgatggaaacaagaaaggggtgaagaaataaaattgatggaatggggataa |
8371681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 218 - 264
Target Start/End: Complemental strand, 45047973 - 45047927
Alignment:
| Q |
218 |
atgatgatggaaacaagaaaggggtgaagaaataaaattgatggaat |
264 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
45047973 |
atgatgatgaaaacaagaaagtggtgaaggaataaaattgatggaat |
45047927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University