View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_24 (Length: 333)
Name: NF1130_low_24
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 11867568 - 11867470
Alignment:
| Q |
30 |
cactgtaatcaaacaatacattttgaattaattgagtttgttttgtgaatgctataaaccagtt-ttttgactagtaacaaatatgttcctgaaaatcg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11867568 |
cactgtaatcaaacaatacattttgaattaattaagtttgttttgtgaatgctataaaccagttgttttgactagtaacaaatatgttcctgaaaatcg |
11867470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 234 - 323
Target Start/End: Complemental strand, 11867333 - 11867235
Alignment:
| Q |
234 |
agtactttttatatgttaattactagtaatattcttaaccgtgataaatgtggtag---------ctttgtatttatgtgatatgattattgagaataa |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11867333 |
agtactttttatatgttaattactagtaatattcttaaccgtgataaatgtggtagtagctttgtatttgtatttatgtgatatgattattgagaataa |
11867235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 191 - 250
Target Start/End: Complemental strand, 11867408 - 11867349
Alignment:
| Q |
191 |
gaattgtgagattcttgtggtggaaaccaattaagaagacatcagtactttttatatgtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11867408 |
gaattgtgagattcttgtggtggaaaccaattaagaagacatcagtactttttatatgtt |
11867349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 251 - 297
Target Start/End: Original strand, 22674646 - 22674692
Alignment:
| Q |
251 |
aattactagtaatattcttaaccgtgataaatgtggtagctttgtat |
297 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22674646 |
aattactagtaagattcttaaccgtgataaatgtggtagctttgtat |
22674692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University