View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_26 (Length: 322)
Name: NF1130_low_26
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 96 - 241
Target Start/End: Complemental strand, 37716941 - 37716791
Alignment:
| Q |
96 |
gatgttaggatgatacaatacatcatggagatattggtcacacttactannnnnnnn-----gcaaagaatcacacttttcttagtctttttgtaaaatg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716941 |
gatgttaggatgatacaatacatcatggagatattggtcacacttcttactttttttttttggcaaagaatcacacttttcttagtctttttgtaaaatg |
37716842 |
T |
 |
| Q |
191 |
ctggtctaggatttctaatagttatctttgacacttggtttcctaagcaat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37716841 |
ctggtctaggatttctaatagttatctttgacacttggtttcctaagcaat |
37716791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University