View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_28 (Length: 317)
Name: NF1130_low_28
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_28 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 96 - 317
Target Start/End: Original strand, 42166777 - 42167003
Alignment:
| Q |
96 |
gaatctttttagctaggggaaatgaacgatgaaatttacgcaaccgataatgt------ggtgcgattggatatatttcgtagnnnnnnnnnngaaaaga |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||| || |
|
|
| T |
42166777 |
gaatctttttagctaggggaaatgaacgatgaaatttacgcaaccggtaatgtcgacacggtgcgattggatatatttcgtagttcttttttggaaa-ga |
42166875 |
T |
|
| Q |
190 |
atatttcgtagttttttgaattcaaatccagaatttttcgatttgtctgtgataatttatagtagtcgtctacatgcaaaataaataaatatgactannn |
289 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42166876 |
atattttgtagttttttgaattcgaatccagaatttttcgatttgtctgtgataatttatagtggtcgtctacatgcaaaataaataaatatgactattt |
42166975 |
T |
|
| Q |
290 |
nnnnnaaggaaaataaatatgactatta |
317 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
42166976 |
tttttaaggaaaaaaaatatgactatta |
42167003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University