View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_30 (Length: 287)
Name: NF1130_low_30
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 29623784 - 29623837
Alignment:
| Q |
125 |
cttatcatatcaagtgtttggtatagcattattttgttttttcatatgtttgtt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
29623784 |
cttatcatatcaagtgtttgggatagcattattttgtcttttcatatgtttgtt |
29623837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 192 - 223
Target Start/End: Original strand, 29623855 - 29623886
Alignment:
| Q |
192 |
tttgataagcagataagatgtatattatattt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29623855 |
tttgataagcagataagatgtatattatattt |
29623886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University