View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_31 (Length: 286)
Name: NF1130_low_31
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 40 - 223
Target Start/End: Original strand, 1610985 - 1611168
Alignment:
| Q |
40 |
tctccaaaaatatagaccagttgctcaaagataatatcttgtagcatactagtttcactacatgggggcgaatttcgctcctagtagaactacaagaggg |
139 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610985 |
tctccaaaaatgcagaccagttgctcaaagataatatcttgtagcatactagtttcactacatgggggcgaatttcgctcctagtagaactacaagaggg |
1611084 |
T |
 |
| Q |
140 |
aagtttcaacacatcattgaaaagattcaaaataggttaagtgggtggaagcatcaatgtcttagcttcgctgatagacttact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1611085 |
aagtttcaacacatcattgaaaagattcaaaataggttaagtgggtggaagcatcaatgtcttagcttcgccgatagacttact |
1611168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University