View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_33 (Length: 275)
Name: NF1130_low_33
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 52 - 176
Target Start/End: Complemental strand, 34882977 - 34882840
Alignment:
| Q |
52 |
catatttcatgtaatgaaaatgtagtcaatgattgtcgtttat------------gtaacacatgagcctattttatgtaacacataaatatgtact-at |
138 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
34882977 |
catatttcatgtaatgaaaatgtagttaatgattgtcgtttatctatatatttatgtaacacatgagcctattttatgtaacacataaatatgtagtcat |
34882878 |
T |
 |
| Q |
139 |
tagttgttggttatcgatatcttcatgtaacacatgaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34882877 |
tagttgttggttatcgatatcttcatgtaacacatgaa |
34882840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 170 - 242
Target Start/End: Complemental strand, 34882799 - 34882727
Alignment:
| Q |
170 |
acatgaacatgtacttgttagtagttggttttttcaggcaattaattgttcattataaatcaaatttcattcg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34882799 |
acatgaacatgtacttgttagtagttggtttttttaggcaattaattgttcattataaatcaaatttcattcg |
34882727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University