View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_35 (Length: 274)
Name: NF1130_low_35
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 10 - 97
Target Start/End: Original strand, 5998952 - 5999039
Alignment:
| Q |
10 |
gttctctaattttctctcttttgaaaagtggcttcacctttcttaagtactttttcactgcatgtaacacatcaaaatcaaatctcag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998952 |
gttctctaattttctctcttttgaaaagtggcttcacctttcttaagtactttttcactgcatgtaacacatcaaaatcaaatctcag |
5999039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 133 - 212
Target Start/End: Original strand, 5999075 - 5999154
Alignment:
| Q |
133 |
taagacacccttttggtgctttatttgaactaaatgataaaaaagaaaacttggacttaccctctaccttttttgatgat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5999075 |
taagacacccttttggtgctttatttgaactaaatgataaaaaagaaaacttggacttaccctctaccttttttgatgat |
5999154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University