View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_45 (Length: 248)
Name: NF1130_low_45
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_45 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 4 - 248
Target Start/End: Complemental strand, 50118249 - 50118006
Alignment:
| Q |
4 |
ctccaacaatatcaccatcaccgagcaatggcaagtgaaactgcctttttgaccagatcctcccgtactgtacagcatcaaatacaatgtcagcactaag |
103 |
Q |
| |
|
||||| || |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50118249 |
ctccaccactatcaccatcac-gagcaatggcaagtaaaactgcctttttgaccagatcctcccgtactgtacagcatcaaatacaatgtcagcactaag |
50118151 |
T |
 |
| Q |
104 |
gattgagatggaaattnnnnnnnnnnnnnnnnnnnncctcagaatttctaatatttgaaccatagaagagttataactaatccaaagccaatgttgtatt |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50118150 |
gattgagatggaaattccccctccccccaaaaaaaacctcagaatttctaatatttgaaccatagaagagttataactaatccaaagccattgttgtatt |
50118051 |
T |
 |
| Q |
204 |
gctgcggctacaaccaatccaccatattcttccatactttctacc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50118050 |
gctgcggctacaaccaatccaccatattcttccatactttctacc |
50118006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 50490415 - 50490462
Alignment:
| Q |
16 |
caccatcaccgagcaatggcaagtgaaactgcctttttgaccagatcct |
64 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50490415 |
caccatcac-gagcaatggcaagtgaaactgcctttttgactagatcct |
50490462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University