View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1130_low_7 (Length: 468)
Name: NF1130_low_7
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1130_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 292
Target Start/End: Complemental strand, 7246311 - 7246049
Alignment:
| Q |
30 |
acttgatcattctcattttcaaactcaagatgctactactcatcacctctttttggactcaacatcttattctcatgatgacaaggactttaggtatgta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7246311 |
acttgatcattctcattttcaaactcaagatgctactactcatcacctctttttggactcaacatcttattctcaggatgacaaggactttaggtatgta |
7246212 |
T |
|
| Q |
130 |
taaaaccaataaattctaaattgttgtttcagttacgctgccaacttttatatttatatctaatgcagttgaaattgcagttgtgataccgttatagaga |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
7246211 |
taaaaccaataaattctaaattgttttttcagttacgctgccaacttttatatttatatctaatgcggttgaaattgcagttgtcataccgttatagaga |
7246112 |
T |
|
| Q |
230 |
cctctaaatatatttatattacgattgcagactgcaatttaaaatcataataaacatacatat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
7246111 |
cctctaaatatatttatattacgattgcagactacaatttaaaatcataataaacatatatat |
7246049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 306 - 457
Target Start/End: Complemental strand, 7246004 - 7245853
Alignment:
| Q |
306 |
ttgctaggttttgatannnnnnngtgtatgtgttattgtacttgattgttgataaaggaggcaagttcaaggaataagagatggtactgtggataagaga |
405 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7246004 |
ttgctaggttttgatattttgttgtgtatgtgttattgtacttgattgttgataaaggaggcaagttcaaggaataagagatggtactgtggatgagaga |
7245905 |
T |
|
| Q |
406 |
actttctttccagaagctacaggttcatctaggagctgttatcatgattcat |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7245904 |
actttctttccagaagctacaggttcatctaggagctgttatcatgattcat |
7245853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 189 - 252
Target Start/End: Complemental strand, 22482719 - 22482657
Alignment:
| Q |
189 |
ctaatgcagttgaaattgcagttgtgataccgttatagagacctctaaatatatttatattacg |
252 |
Q |
| |
|
|||||||||||| |||||| |||||||| ||||||| ||||||||||| || ||||||||||| |
|
|
| T |
22482719 |
ctaatgcagttgcaattgcggttgtgatggcgttataaagacctctaaa-atctttatattacg |
22482657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University