View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11310_high_8 (Length: 250)
Name: NF11310_high_8
Description: NF11310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11310_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 24345545 - 24345310
Alignment:
| Q |
1 |
ccctttgttgctgcattttccggttttggtgatccaattccatggttgatttgtttagcttttttctttgctaaaggttttatcaaaactggattaggta |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24345545 |
ccctttgttgcagcattttccggttttggtgatccaattccatggttgatttgtctagcttttttctttgctaaaggttttatcaaaactggattaggta |
24345446 |
T |
|
| Q |
101 |
accgtgttgcgtatcaatttgtgaagcttttcggtagttcttcgttagggttaggttatagtttggtttttagtgaagcattgttagctcccgcgattcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24345445 |
accgtgttgcgtatcaatttgtgaagctttttggtagttcttcattagggttaggttatagtttggtttttagtgaagcattgttagctccggcgattcc |
24345346 |
T |
|
| Q |
201 |
ttcggtttcggcaagggctggtgggatatttttacc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24345345 |
ttcggtttcggcaagggctggtgggatatttttacc |
24345310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University