View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11310_low_6 (Length: 331)
Name: NF11310_low_6
Description: NF11310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11310_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 140 - 318
Target Start/End: Complemental strand, 6368027 - 6367849
Alignment:
| Q |
140 |
caaataagttttagaatttataaacgcggcatcagattctatctgttttcacaaaaagaaattcaacaaatatcttataatatccaattttgttgcatag |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6368027 |
caaataagttttagaatttataaacgcggcatcagattctatctgttttcacaaaaagaaattcaacaaatatcttataatatccaattttgttgcatag |
6367928 |
T |
|
| Q |
240 |
gttttagttttttaaattgatttggagatattaactcttctacccatcttggatcatctctctcaacaccttccatcct |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6367927 |
gttttagttttttaaattgatttggagatgttaacacttctacccatcttggatcatctctctcaacaccttccatcct |
6367849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 72
Target Start/End: Complemental strand, 6368147 - 6368094
Alignment:
| Q |
19 |
ggttacccttgttaggttaagatgtaattttctcgagccttttggccctctatg |
72 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6368147 |
ggttaccctcgttaggttaagatgtaattttctcgagccttttgaccctctatg |
6368094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University