View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11310_low_8 (Length: 250)

Name: NF11310_low_8
Description: NF11310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11310_low_8
NF11310_low_8
[»] chr4 (1 HSPs)
chr4 (1-236)||(24345310-24345545)


Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 24345545 - 24345310
Alignment:
1 ccctttgttgctgcattttccggttttggtgatccaattccatggttgatttgtttagcttttttctttgctaaaggttttatcaaaactggattaggta 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
24345545 ccctttgttgcagcattttccggttttggtgatccaattccatggttgatttgtctagcttttttctttgctaaaggttttatcaaaactggattaggta 24345446  T
101 accgtgttgcgtatcaatttgtgaagcttttcggtagttcttcgttagggttaggttatagtttggtttttagtgaagcattgttagctcccgcgattcc 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
24345445 accgtgttgcgtatcaatttgtgaagctttttggtagttcttcattagggttaggttatagtttggtttttagtgaagcattgttagctccggcgattcc 24345346  T
201 ttcggtttcggcaagggctggtgggatatttttacc 236  Q
    ||||||||||||||||||||||||||||||||||||    
24345345 ttcggtttcggcaagggctggtgggatatttttacc 24345310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University