View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11311_low_12 (Length: 236)
Name: NF11311_low_12
Description: NF11311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11311_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43685858 - 43685648
Alignment:
| Q |
1 |
ccaagtttggtggaacttttt-cctttatatgattctttttcatacaagtgattatatcacttttgaattgtaaaaaggaatctaaggagaacttgtcag |
99 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43685858 |
ccaagtttggtggaacttttttcctttatatgattctttttcatacaagtgattatatcacttttgaattgtaaaaaggaatctag-------ttg---- |
43685770 |
T |
|
| Q |
100 |
aatatcatagttgaatattttatttaactactataatatttaattgaaacgggctcaatatatgtcgactatgatcttcaatatatcagacacgccgcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43685769 |
aatatcatagttgaatattttatttaactactataatatttaattgatacgggctcaatatatgtcgactatgatcttcaatatatcagacacgccgcat |
43685670 |
T |
|
| Q |
200 |
attgtcttgcctaagaccatac |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43685669 |
attgtcttgcctaagaccatac |
43685648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 43713218 - 43713170
Alignment:
| Q |
1 |
ccaagtttggtggaac-tttttcctttatatgattctttttcatacaag |
48 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
43713218 |
ccaagtttggtggaacatttttcctttgtatgcttctttttcatacaag |
43713170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University