View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11311_low_16 (Length: 205)
Name: NF11311_low_16
Description: NF11311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11311_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 39369564 - 39369389
Alignment:
| Q |
17 |
aataacactgactataatgttatgcagcaagtaactaacagcatatattgcacctacatgacatcagcgcttaccaataatgacatgataaaagatattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39369564 |
aataacactgactataatgttatgcaacaagtaactaacagcatatattgcacctacatgacatcagcgcttaccaataatgacatgataaaagatattt |
39369465 |
T |
 |
| Q |
117 |
tgcatggtacatcgttctcatctttaaacgtatatgtttttacaacatccgttatatgcttcaccaatatctctgc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39369464 |
tgcatggtacatcgttctcatctttaaacgtatatgttttaacaacatccgttatatgcttcaccaatatctctgc |
39369389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 59 - 175
Target Start/End: Complemental strand, 39355339 - 39355223
Alignment:
| Q |
59 |
atatattgcacctacatgacatcagcgcttaccaataatgacatgataaaagatattttgcatggtacatcgttctcatctttaaacgtatatgttttta |
158 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||| ||| ||||||||||| |||||| | || |||| |||| ||| ||||| | |
|
|
| T |
39355339 |
atatattgcatgcacatgacatcggcacttaccaataatgacatgatgaaaactattttgcatgatacatcatgcttgtcttcaaacttatctgtttctg |
39355240 |
T |
 |
| Q |
159 |
caacatccgttatatgc |
175 |
Q |
| |
|
||||||| | ||||||| |
|
|
| T |
39355239 |
caacatctgctatatgc |
39355223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University