View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11311_low_6 (Length: 365)
Name: NF11311_low_6
Description: NF11311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11311_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 6495631 - 6495861
Alignment:
| Q |
19 |
gcagccagtgttggccttctgtttttgggagctgttgtgtgctattggtggggcagcagcgctgctgggtcgtctgggttgagttctgctggctggctgt |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6495631 |
gcagccagcgttggccttctgtttttgggagcttctgtgtgctattggtggggcagcagcgctgctgggtcgtctgggttgagttatgctggctggctgt |
6495730 |
T |
|
| Q |
119 |
gtgggcgtggaggttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgatttttggcagtcgtgttgctgctactgtgatgcagcct |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
6495731 |
gtgggcgtggatgttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgattgttggcagtcgtgttgctgttactgtgatgcagcct |
6495830 |
T |
|
| Q |
219 |
gcgcttttggcctgtagctgttacatattca |
249 |
Q |
| |
|
|| ||||||||||||||||||||||| |||| |
|
|
| T |
6495831 |
gcacttttggcctgtagctgttacattttca |
6495861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 284 - 359
Target Start/End: Original strand, 6495896 - 6495971
Alignment:
| Q |
284 |
agtcctctccgtgttggatttggactcttaggggttttttgatcgagtttgtttgtagtagtgtgctgcggtctgt |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6495896 |
agtcctctccgtgttggatttggactcttagggggttttttatcgagtttgtttgtagtagtgtgctgcggtctgt |
6495971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University