View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11311_low_8 (Length: 311)
Name: NF11311_low_8
Description: NF11311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11311_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 298
Target Start/End: Original strand, 32582411 - 32582692
Alignment:
| Q |
17 |
acttcccaaccaccggcgatgacgcttcttccaccaccacctcctccttgacatggtggttacttccacaactcgacgctgcatcttcatcgttacggtg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32582411 |
acttcccaaccaccggcgatgacgcttcttccaccaccacctcctccttgacatggtggttacttccacaactcgacgctgcatcgtcatcgttacggtg |
32582510 |
T |
 |
| Q |
117 |
attctcaacatgcgccagaacttgttctaattcgttacgtaacgtgtttacagcagattcgttagtcaaagccatttctctccaaatctgattctccata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582511 |
attctcaacatgcgccagaacttgttctaattcgttacgtaacgtgtttacagcagattcgtttgtcaaagccatttctctccaaatctgattctccata |
32582610 |
T |
 |
| Q |
217 |
atcagtgttttcgctttttcttgaagcattagattttgtttctccattctctgaatctcttcttctttttgcttcagtttct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582611 |
atcagtgttttcgctttttcttgaagcattagattttgtttctccattctctgaatctcttcttctttttgcttcagtttct |
32582692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University