View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11312_low_7 (Length: 309)
Name: NF11312_low_7
Description: NF11312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11312_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 40959970 - 40960219
Alignment:
| Q |
11 |
cacagaccaccctgcattggacccaatgatttgtttttcttgtattttcattgaggcatccttcttgggttaattgatcacatagggc----aaattatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40959970 |
cacagaccaccctgcattggacccaatgatttgtttttcttgtattttcattgaggcatccttcttgggttaattgatcacatagggccaacaaattatt |
40960069 |
T |
 |
| Q |
107 |
ggaccaatattttggtggccatatgtgatcaattgatgataaaatagtactataatccatatctttggcatatgtggtcattattttctgtgatgatgat |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960070 |
gaaccaatattttggtggccatatgtgatcaattgatgataaaatagtactataatccatatctttggcatatgtggtcattattttctgtgatgatgat |
40960169 |
T |
 |
| Q |
207 |
ttgaaggtagactgtaccaattaaaagcgttggagttggtacatgatagg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960170 |
ttgaaggtagactgtaccaattaaaagcgttggagttggtacatgatagg |
40960219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 22506487 - 22506429
Alignment:
| Q |
15 |
gaccaccctgcattggacccaatgatttgtttttcttgtattttcattgaggcatcctt |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
22506487 |
gaccaccctgcattggacccaatgatttaattttcttgtattttcatggaggcatcctt |
22506429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University