View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11313_low_2 (Length: 337)
Name: NF11313_low_2
Description: NF11313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11313_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 16 - 324
Target Start/End: Complemental strand, 6692412 - 6692104
Alignment:
| Q |
16 |
ttttcttctaaacttctgtgtttggagtgtcaaccattcaggcaggctgcagaatgctggaacggagaaggttcttttctgtatacatcaagttctgctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6692412 |
ttttcttctaaacttctgtgtttggagtgtcaaccattcaggcaggctgcagaatgctggaacggagaaggttcttttctgtatacatcaagttctgctc |
6692313 |
T |
|
| Q |
116 |
cttatgattgtaacgataatggtttatgcgatgaggtagctgctctctctcaagtctccctctctttatccagatattagtttaaatttgtttcaattgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6692312 |
cttatgattgtaacgataatggtttatgcgatgaggtagctgctctctctcaagtctccctctctttatcctgatattagtttaaatttgtttcaattgc |
6692213 |
T |
|
| Q |
216 |
aaaaattgtggcattaggaatcacttattgttcatgaaactagattcacttacttctacgcaggatactccggtcgtgccaattgggaggagcccgagaa |
315 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6692212 |
aaaatttgtggcattaggaatcacttattgttcatgaaactagattcacttacttctacgcaggatactccggtcgtgccaattgggaggagcccgagaa |
6692113 |
T |
|
| Q |
316 |
ctgatgtcc |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
6692112 |
ctgatgtcc |
6692104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University