View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11314_low_1 (Length: 693)
Name: NF11314_low_1
Description: NF11314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11314_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 2e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 22 - 199
Target Start/End: Complemental strand, 33153092 - 33152915
Alignment:
| Q |
22 |
gcgaggaagatcgagtttttggggtagagaatgggcatagtgaaggtgttgatggtgttgttgatgctgatgaggatgaggagagtgatgctgatgagga |
121 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33153092 |
gcgaggaagatcgagtttttggggtggagaatggccatagtgaaggtgttgatggtgttgttgatgctgatgaggatgaggagagtgatgctgatgagga |
33152993 |
T |
|
| Q |
122 |
ggttacggagagttcgagggggagggttaatggggtgagtcatcaggagaatgggtttcatgttgagccggttgatgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33152992 |
ggttacggagagttcgagggggagggttaatggggtgagtcatcaggagaatgggtttcatgtcgagccggttgatgt |
33152915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 2e-54
Query Start/End: Original strand, 371 - 487
Target Start/End: Complemental strand, 33152743 - 33152627
Alignment:
| Q |
371 |
aggggattttgctgagcctgagagtacttctgggcggttggtgagtgctgaaggtgagatcgatgggcacgagcaaggggaggaagatggagatgaagat |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33152743 |
aggggattttgctgagcctgagagtacttctgggcggttggtgagtactgaaggtgagatcgatgggcatgagcaaggggaggaagatggagatgaagat |
33152644 |
T |
|
| Q |
471 |
gacaatggagagaccgg |
487 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33152643 |
gacaatggagagaccgg |
33152627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University