View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11314_low_3 (Length: 293)
Name: NF11314_low_3
Description: NF11314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11314_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 9023421 - 9023675
Alignment:
| Q |
14 |
caaatacaacaacctcgtaccctgtctcaagggagacaacaacctcgtacagtgtcccaagagagagagtggactgtatagtgataggagctggtgtgat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
9023421 |
caaatacaacaacctcgtaccctgtctcaagggagacaacaacctcgtacagtgtcccaagagagagagtggactgtgtagtgataggagctggtgtggt |
9023520 |
T |
 |
| Q |
114 |
tggaatagcagttgcaagagcattggcattgaagggtagagaggtaattgtcattgaatcagcacctagttttggtactggaactagttcaagaaacagt |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9023521 |
tggaatagcagtggcaagagcattggcattgaagggtagagaggtaattgtcattgaatcagcacctagttttggtactggaactagttcaagaaacagt |
9023620 |
T |
 |
| Q |
214 |
gaagttgttcatgctggaatttattatcctcatcattctcttaaggttggtttgt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9023621 |
gaagttgttcatgctggaatttattatcctcatcattctcttaaggttggtttgt |
9023675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 264
Target Start/End: Complemental strand, 8952853 - 8952790
Alignment:
| Q |
201 |
ttcaagaaacagtgaagttgttcatgctggaatttattatcctcatcattctcttaaggttggt |
264 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
8952853 |
ttcaagaaacaatgaagttgttcatgctggtatttattatcctcggtattcttttaaggttggt |
8952790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 261
Target Start/End: Complemental strand, 8954383 - 8954335
Alignment:
| Q |
213 |
tgaagttgttcatgctggaatttattatcctcatcattctcttaaggtt |
261 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
8954383 |
tgaagttgttcatgctagaatttattatcctcatcattcttttgaggtt |
8954335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 261
Target Start/End: Original strand, 8966330 - 8966378
Alignment:
| Q |
213 |
tgaagttgttcatgctggaatttattatcctcatcattctcttaaggtt |
261 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
8966330 |
tgaagttgttcatgctagaatttattatcctcatcattcttttgaggtt |
8966378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University