View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11315_high_12 (Length: 217)

Name: NF11315_high_12
Description: NF11315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11315_high_12
NF11315_high_12
[»] chr1 (1 HSPs)
chr1 (1-211)||(44186689-44186891)
[»] chr5 (3 HSPs)
chr5 (97-169)||(28995464-28995535)
chr5 (97-170)||(28990134-28990206)
chr5 (97-169)||(28992178-28992249)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 44186891 - 44186689
Alignment:
1 ttgttatttctcattgatttgagaagctttaagtttaaagagtatgatgtatagcagcatgttgttgtctttgagcttcaatttgttgtaacttttgcaa 100  Q
    ||||||||||||||||||||||||| ||||||      |||||||||||| ||||||||||||||| ||||| || ||  ||||||||||||||||||||    
44186891 ttgttatttctcattgatttgagaatctttaa------agagtatgatgtgtagcagcatgttgttatctttaagtttacatttgttgtaacttttgcaa 44186798  T
101 agattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgtttgggatttgatctgaaatcagaaatgtgat 200  Q
    ||||||||||| |||||| ||  |||||||||||||||||||||| ||||||| | ||||| ||||||||||||||||||||||||||||||||||||||    
44186797 agattttgtatagtgatgttt--tttatgcaatgattgtattgttgtcaaatgatcttttagcctttgtttgggatttgatctgaaatcagaaatgtgat 44186700  T
201 agtgaatctct 211  Q
    |||||| ||||    
44186699 agtgaagctct 44186689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 28995464 - 28995535
Alignment:
97 gcaaagattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgt 169  Q
    ||||||||| ||||||||||||| | |||||||||||| ||||||| || || |||| ||||||||| |||||    
28995464 gcaaagattatgtattgtgatggat-ttttatgcaatgtttgtattattgtccaatgatattttaacatttgt 28995535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 97 - 170
Target Start/End: Original strand, 28990134 - 28990206
Alignment:
97 gcaaagattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgtt 170  Q
    ||||||| | ||||||||||||| | |||||||||||| ||||||| || || |||| ||||||||| ||||||    
28990134 gcaaagaatatgtattgtgatggat-ttttatgcaatgtttgtattattgtccaatgatattttaacatttgtt 28990206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 28992178 - 28992249
Alignment:
97 gcaaagattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgt 169  Q
    ||||||||| || |||||||||| | |||||||||||| ||||||| || || |||| ||||||||| |||||    
28992178 gcaaagattatgcattgtgatggat-ttttatgcaatgtttgtattattgtccaatgatattttaacatttgt 28992249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University