View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11315_high_12 (Length: 217)
Name: NF11315_high_12
Description: NF11315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11315_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 44186891 - 44186689
Alignment:
| Q |
1 |
ttgttatttctcattgatttgagaagctttaagtttaaagagtatgatgtatagcagcatgttgttgtctttgagcttcaatttgttgtaacttttgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||| ||||| || || |||||||||||||||||||| |
|
|
| T |
44186891 |
ttgttatttctcattgatttgagaatctttaa------agagtatgatgtgtagcagcatgttgttatctttaagtttacatttgttgtaacttttgcaa |
44186798 |
T |
|
| Q |
101 |
agattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgtttgggatttgatctgaaatcagaaatgtgat |
200 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||| ||||||| | ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44186797 |
agattttgtatagtgatgttt--tttatgcaatgattgtattgttgtcaaatgatcttttagcctttgtttgggatttgatctgaaatcagaaatgtgat |
44186700 |
T |
|
| Q |
201 |
agtgaatctct |
211 |
Q |
| |
|
|||||| |||| |
|
|
| T |
44186699 |
agtgaagctct |
44186689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 28995464 - 28995535
Alignment:
| Q |
97 |
gcaaagattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgt |
169 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||| ||||||| || || |||| ||||||||| ||||| |
|
|
| T |
28995464 |
gcaaagattatgtattgtgatggat-ttttatgcaatgtttgtattattgtccaatgatattttaacatttgt |
28995535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 97 - 170
Target Start/End: Original strand, 28990134 - 28990206
Alignment:
| Q |
97 |
gcaaagattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgtt |
170 |
Q |
| |
|
||||||| | ||||||||||||| | |||||||||||| ||||||| || || |||| ||||||||| |||||| |
|
|
| T |
28990134 |
gcaaagaatatgtattgtgatggat-ttttatgcaatgtttgtattattgtccaatgatattttaacatttgtt |
28990206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 28992178 - 28992249
Alignment:
| Q |
97 |
gcaaagattttgtattgtgatggttcttttatgcaatgattgtattgttttcaaatggtattttaacctttgt |
169 |
Q |
| |
|
||||||||| || |||||||||| | |||||||||||| ||||||| || || |||| ||||||||| ||||| |
|
|
| T |
28992178 |
gcaaagattatgcattgtgatggat-ttttatgcaatgtttgtattattgtccaatgatattttaacatttgt |
28992249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University