View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11315_low_10 (Length: 270)
Name: NF11315_low_10
Description: NF11315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11315_low_10 |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 27517824 - 27517932
Alignment:
| Q |
1 |
tgtgtgttaagaaataagaagttattgttcaatggtatgaatgagaaagcaaattttaatttgagttgtgaaggtactgatgctgatataattatacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27517824 |
tgtgtgttaagaaataagaagttattgttcaatggtatgaatgagaaagcaaattttaatttgagttgtgaaggtactgatgttgatataattatacaaa |
27517923 |
T |
 |
| Q |
101 |
tcaaagctc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
27517924 |
tcaaagctc |
27517932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 135 - 231
Target Start/End: Original strand, 27517926 - 27518022
Alignment:
| Q |
135 |
aaagctcttgtcgcatcgtaatacattattggttatttcttgaatgttctttgatttgatcttgtttagaattttgaattgaattttaattagaata |
231 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27517926 |
aaagctcttgtcgcatcataatgtattattggttatttcttgaatgttctttgatttgatcttgtttagaattttgaattgaattttaattagaata |
27518022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 36382 - 36334
Alignment:
| Q |
222 |
aattagaatactgttcttcaccgagcacttttcactcgcatcctgcagc |
270 |
Q |
| |
|
||||||||||| | |||||||| |||||||||||||||| ||||||||| |
|
|
| T |
36382 |
aattagaataccgctcttcacccagcacttttcactcgcgtcctgcagc |
36334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 257
Target Start/End: Complemental strand, 11661162 - 11661126
Alignment:
| Q |
221 |
taattagaatactgttcttcaccgagcacttttcact |
257 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
11661162 |
taattagaatactgctcttcacccagcacttttcact |
11661126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University