View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11315_low_7 (Length: 335)
Name: NF11315_low_7
Description: NF11315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11315_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 14 - 319
Target Start/End: Complemental strand, 32764927 - 32764622
Alignment:
| Q |
14 |
aggccatggagggtgttactgtgcctatgatttcattgtctcaaccacataaccttttagtgaagaaaatcaatgaagctgcttctgagtggggtttctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32764927 |
aggccatggagggtgttactgtgcctatgatttcattgtctcaaccacataaccttttagtgaagaaaatcaatgaagctgcttctgagtggggtttctt |
32764828 |
T |
 |
| Q |
114 |
tgtgatcactgaccatggtatatctcaaaaacttattcaaagtttgcaagatgtgggccaggagnnnnnnnctctccctcaaaaggagaaagagacatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32764827 |
tgtgatcactgaccatggtatatctcaaaaacttattcaaagtttgcaagatgtgggccaggagtttttttctctccctcaaaaggagaaagagacatat |
32764728 |
T |
 |
| Q |
214 |
gcaaatgatccatctagtggtaaatttgatggctatggaacaaagatgaccaagaacctggaacaaaaggttgagtgggttgattattattttcatctca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32764727 |
gcaaatgatccatctagtggtaaatttgatggctatggaacaaagatgaccaagaaccttgaacaaaaggttgagtgggttgattattattttcatctca |
32764628 |
T |
 |
| Q |
314 |
tgtctc |
319 |
Q |
| |
|
|||||| |
|
|
| T |
32764627 |
tgtctc |
32764622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University