View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11315_low_9 (Length: 276)
Name: NF11315_low_9
Description: NF11315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11315_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 22328008 - 22327861
Alignment:
| Q |
20 |
tgagagtcgtacacggcggtcacggggacctttcgcggtgcaaactttactgtgacggtctttccgtcctgttgaacggacaatgtgacctccttgtacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22328008 |
tgagagtcgtacacggcggtcacggggacctttcgcggtgcaaactttactgtgacggtctttccgtcctgttgaacggacaatgtgacctccttgtacc |
22327909 |
T |
 |
| Q |
120 |
tccacgatttctcctcctcctccgctgctgctgattctcttcgacgag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22327908 |
tccacgatttctcctcctcctccgctgctgctgattctcttcgacgag |
22327861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University