View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11316_high_1 (Length: 318)
Name: NF11316_high_1
Description: NF11316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11316_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 29772553 - 29772368
Alignment:
| Q |
17 |
ataacaagcagaatgaaccccaattcatccaatctatattttggtgtcattactcaaacctcnnnnnnnnnnnnnnnn-gttacatctcttttggtaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29772553 |
ataacaagcagaatgaaccccaattcatccaatctatattttggtgtcattactcaaacctcaaaaaaataaaaaaaatgttacatctcttttggtaaag |
29772454 |
T |
 |
| Q |
116 |
ttgcaacgagaaacagtagcactggaagccaacgtaaatgtgaatatgtgata-tttaagaatttcaaatatgtattttccatccct |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
29772453 |
ttgcaacgagaaacagcagcactggaagccaacgtaaatgtgaatatgtgataatttaaga-tttcaaatatgtattttccatccct |
29772368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University