View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11317_high_1 (Length: 312)
Name: NF11317_high_1
Description: NF11317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11317_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 109 - 297
Target Start/End: Original strand, 21327139 - 21327327
Alignment:
| Q |
109 |
gaaatgtgaagaagacatcaaaaatatttttcaaacttgtaattttgtctttgactttgagtttgtatatgtgagactgaaaagagaggttttatggtag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21327139 |
gaaatgtgaagaagacatcaaaaatattttttaaacttgtaattttgtctttgattttgagtttgtatatgtgagactgaaaagagaggttttatggtag |
21327238 |
T |
 |
| Q |
209 |
attggtgtaaaagggttgaaaataagtgtcttaaataggctcgtgaatagctgaagaatgcagatatttttacagctcattggtatagt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21327239 |
attggtgtaaaagggttgaaaataagtgtcttaaataggctcgtgaatagctgaagaatgcagatatttttacagctcattggtatagt |
21327327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University