View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11319_low_6 (Length: 376)
Name: NF11319_low_6
Description: NF11319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11319_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 37916519 - 37916312
Alignment:
| Q |
17 |
acttcccatactgagaacccccttccccagcac--------cgctacccggtgcttcagaatgtcttggaattgcttcgtcaaataagggctatgaaaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37916519 |
acttcccatactgagaacccccttccccagcacggcagcaccgctacccggtgcttcagaatgtcttggaattgcttcgtcaaataagggctacgaaaaa |
37916420 |
T |
 |
| Q |
109 |
tgacgcttcaaacgaacattttacttctcatttgtcgaagaagcagaagaaacaactcaccaaagtcactacacacaacatccgttccaagggcgactga |
208 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37916419 |
tgacgcttcaaacgaacattttactcctcatttgttgaagaagcagaagaaacaactcaccaaagtcactacacacaacacccgttccaagggcgactga |
37916320 |
T |
 |
| Q |
209 |
ggagcata |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
37916319 |
ggagcata |
37916312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 312 - 368
Target Start/End: Complemental strand, 37916215 - 37916159
Alignment:
| Q |
312 |
gaggtgccaatcttgttagatgtctgagtctcctcttaatgtatttcctttcttctc |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916215 |
gaggtgccaatcttgttagatgtctgagtctcctcttaatgtatttcctttcttctc |
37916159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University