View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11320_high_1 (Length: 479)
Name: NF11320_high_1
Description: NF11320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11320_high_1 |
 | |
|
| [»] scaffold0054 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 3e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 24415430 - 24415238
Alignment:
| Q |
17 |
gaacagtagaggtgagaatcgataatagattggtaaaccatgatatctaaaagcaaaatagtaaattggaaacaaaccaaaactaaaactgtcactttct |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24415430 |
gaacaatagaggtgagaatcgataatagattggtaaaccatgatatgtaaaagcaaaatagtaaattggaaacaaaccaaaactaaaactgtcactttct |
24415331 |
T |
|
| Q |
117 |
tattatgagccttttttcatcttccaaggtagtattattatacttatttatttttgatgcatttcccgttttcattttggtactagcctatga |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24415330 |
tattatgacccttttttcatcttccaaggtagtattattatacttatttatttttgatgcatttcccgttatcattttggtactagcctatga |
24415238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 214 - 312
Target Start/End: Complemental strand, 36086048 - 36085951
Alignment:
| Q |
214 |
attcaactgaatttgatgatgaatttctgatttgtgagtttcatgatcctaattg-tgagttttttctaatttatgagttttaggttttagattcttatg |
312 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||||||| ||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
36086048 |
attcaactgaatttgatgatgagtttctgatttg--agtttcacgatcctaatttatgagtttaatctagtttatgagttttaggttttagattcttatg |
36085951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 56; Significance: 5e-23; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 141 - 208
Target Start/End: Complemental strand, 42546 - 42480
Alignment:
| Q |
141 |
caaggtagtattattatacttatttatttttgatgcatttcccgttttcattttggtactagcctatg |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546 |
caaggtagtagtattatacttatttattttt-atgcatttcccgttttcattttggtactagcctatg |
42480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 76 - 119
Target Start/End: Complemental strand, 38206 - 38163
Alignment:
| Q |
76 |
agtaaattggaaacaaaccaaaactaaaactgtcactttcttat |
119 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
38206 |
agtaaattggaaacaaacacaaattaaaactgtcactttcttat |
38163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 277 - 309
Target Start/End: Complemental strand, 1335093 - 1335061
Alignment:
| Q |
277 |
ttctaatttatgagttttaggttttagattctt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1335093 |
ttctaatttatgagttttaggttttagattctt |
1335061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University