View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11320_high_2 (Length: 332)
Name: NF11320_high_2
Description: NF11320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11320_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 18 - 167
Target Start/End: Original strand, 34357307 - 34357456
Alignment:
| Q |
18 |
gttctgtactccttatgggttgtgtattcctcagtctcctcctacttataatactgatgtccaaacaaccccagctcaaagtggttattctgaagttcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34357307 |
gttctgtactccttatgggttgtgtattcctcagtctcctcctacttataatgctgatgtccaaacaaccccagctcaaagtggttattctgaagttcaa |
34357406 |
T |
 |
| Q |
118 |
aacccaaatccatgatcagagactgttttcatgcatggtttgtgttaatg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34357407 |
aacccaaatccatgatcagagactgttttcatgcatggtttgtgttaatg |
34357456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 319
Target Start/End: Original strand, 34357562 - 34357596
Alignment:
| Q |
285 |
cgagtcttgagttgtgtgttattgattcctcttct |
319 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34357562 |
cgagtcttgagttatgtgttattgattcctcttct |
34357596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University