View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11320_low_4 (Length: 270)
Name: NF11320_low_4
Description: NF11320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11320_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 10275151 - 10275394
Alignment:
| Q |
18 |
caatattaaactttattgacccaactgtaagacaaaattgcaa-tttttgctgttctccctacacttgcaaagcaaagcgagacaaataccatcaatttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10275151 |
caatattaaactttattgacccaactgtaagacaaaattgcaactttttgctgttctccctacacttgcaaagaaaagcgagacaaataccatcaattta |
10275250 |
T |
|
| Q |
117 |
taaagagnnnnnnnnn-ctannnnnnnatgaagggatttatttgtcgattcaaaaaattattatatctatctctttcttatttctcttctatttttctag |
215 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10275251 |
taaagagaaaaaaaaaactatttttttatgaagggacttatttgtcgattcaaaaaattattatatttatctctttcttatttctcttctatttttctag |
10275350 |
T |
|
| Q |
216 |
taccaaacaatcaaatcaattacattttttatttctttctctct |
259 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10275351 |
taccaaacaatcaaatcagttacattttttatttctttctctct |
10275394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University