View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11321_low_14 (Length: 239)
Name: NF11321_low_14
Description: NF11321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11321_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 21 - 229
Target Start/End: Original strand, 27801193 - 27801401
Alignment:
| Q |
21 |
acactttccattcttttggccggtagatataagcacattgtgaaccctcatgaggttggtttgtcacaaactttagttgattagatcttcannnnnnnnn |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
27801193 |
acactttccattcttttggccggtagatataagcacattgtgaaccctcatgaggttggtttgtcacaagctttagttgatcagatcttcatttttattt |
27801292 |
T |
 |
| Q |
121 |
nnnnnnngctttctgttaagtaatcattattgttcaattgacaaatatgcagagatttgggataataatgaggggattacaggatgcccttatagtttct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27801293 |
ttgttttgctttctgttaagtaatcattattgttcaattgacaaatatgcagagatttgggataataatgaggggattacaggatgcccttatagtttct |
27801392 |
T |
 |
| Q |
221 |
tcatctctc |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
27801393 |
tcatctctc |
27801401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 26475066 - 26474868
Alignment:
| Q |
25 |
tttccattcttttggccggtagatataagcacattgtgaaccctcatgaggttggtttgtcacaaactttagttgattagatcttcannnnnnnnnnnnn |
124 |
Q |
| |
|
|||| ||| ||||||| |||||||||| |||||||||| ||||||||||||||||| || |||| || ||||||||| ||||||| |
|
|
| T |
26475066 |
tttcaattattttggctggtagatatagtgacattgtgaatcctcatgaggttggtttctcgcaaatttaagttgattatatcttcatttttatttttgt |
26474967 |
T |
 |
| Q |
125 |
nnngctttctgttaagtaatcattattgttcaattgacaaatatgcagagatttgggataataatgaggggattacaggatgcccttatagtttcttca |
223 |
Q |
| |
|
| ||||| ||| ||||||||| |||| |||||||||||||||||| ||||| || |||||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
26474966 |
tttgttttctattatgtaatcattgttgtctaattgacaaatatgcagaaatttgagaagataatgaggggaacacagggtgcccttatagttgcttca |
26474868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University