View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11323_high_6 (Length: 250)
Name: NF11323_high_6
Description: NF11323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11323_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 4172477 - 4172262
Alignment:
| Q |
19 |
gaacacacagcacacaatctcgccaccactcaacggtaatacctacctgtagcaagtagctacgatcaaacacaatctgaattgaacatgtccatggcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4172477 |
gaacacacagcacacaatctcgccaccactcaacggtaatacctacctgtagctagtagctacgatcaaacacaatctgaattgaacatgtccatggcta |
4172378 |
T |
 |
| Q |
119 |
caacaacctcgtcttttatgattcttaaatctccaacttgtcataccagaattggatctctcagaagttccaaattaatcaaggttcaatcttcagtcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4172377 |
caacaacctcgtcttttatgattcttaaatctccaacttgtcataccagaattggatctctcagaagttccaaattaatcaaggttcaatcttcagtcca |
4172278 |
T |
 |
| Q |
219 |
aaaggaacatgatgtc |
234 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
4172277 |
aaaggaacatgttgtc |
4172262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 147
Target Start/End: Complemental strand, 4176565 - 4176504
Alignment:
| Q |
83 |
atcaaacacaatctgaattgaacatgtccatggctacaacaacctcgtcttttatgattcttaaa |
147 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
4176565 |
atcaaacacaaacagaattgaacat---catggctacaacaacttcgtcttttatgtttcttaaa |
4176504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University