View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11323_low_5 (Length: 251)
Name: NF11323_low_5
Description: NF11323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11323_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 45565877 - 45566096
Alignment:
| Q |
21 |
atcgcgcattggtgtcaccatccttaagccaaatcacctttgctatttgtttccaaaatgcttctgcttgtgccaataatcctcccattcaaatatgtac |
120 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45565877 |
atcgcgcattggtatcaccatccttaagccaaatcacctttgctatttgtttccaaaatgcttctgcttgtgccaataatcctctcattcaaatatgtac |
45565976 |
T |
 |
| Q |
121 |
ctccttagagcgcccaatttgggaagcttgcacgctgcccctaaatctatctaactcatcccgacattcatcaatggaaacttgatacttactttggagc |
220 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45565977 |
ctccttagagcgcgcaatttgggaagcttgcacgctgcccctaaatctctctaactcatcccgacattcatcaatggaaactcgatacttactttggagc |
45566076 |
T |
 |
| Q |
221 |
tttcttcccggttcgttcat |
240 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
45566077 |
tttcttccccgttcgttcat |
45566096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 96
Target Start/End: Original strand, 8179388 - 8179449
Alignment:
| Q |
35 |
tcaccatccttaagccaaatcacctttgctatttgtttccaaaatgcttctgcttgtgccaa |
96 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||| |||||||| |||||| |||||||||| |
|
|
| T |
8179388 |
tcaccatccttcagccaaatcaccttagctctttgcttccaaaacgcttcttcttgtgccaa |
8179449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University