View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_high_10 (Length: 413)
Name: NF11324A_high_10
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 216
Target Start/End: Original strand, 32523003 - 32523212
Alignment:
| Q |
7 |
tttggtgttgacgatggtgacgtgggaggacatttggacgtggatgccgtcggtgtttgggctgtttccggctgccatgatattgacaccttgcgttttt |
106 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32523003 |
tttggagttgacgatggtgacatgggaggacatttggacgtggatgccgtcggtgtttgggctgtttccggctgccatgatattgacaccttgcattttt |
32523102 |
T |
|
| Q |
107 |
acattttcgcatccattgaacactatgtggaacatttgactattcattgatgtcaaaccactaatcataatgttttttgagttactaaattccaacgtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523103 |
acattttcgcatccattgaacactatgtggaacatttgactattcattgatgtcaaaccactaatcataatgttttttgagttactaaattccaacgtct |
32523202 |
T |
|
| Q |
207 |
ggaaaccacc |
216 |
Q |
| |
|
| |||||||| |
|
|
| T |
32523203 |
gaaaaccacc |
32523212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 342 - 413
Target Start/End: Original strand, 32523477 - 32523548
Alignment:
| Q |
342 |
attgttttgtgtaatatgtgcaatatgatttataaacaaaccagaaagaatcatatgatataaccaattatt |
413 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523477 |
attggtttgtgtgatatgtgcaatatgatttataaacaaaccagaaagaatcatatgatataaccaattatt |
32523548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 247 - 339
Target Start/End: Original strand, 32523249 - 32523341
Alignment:
| Q |
247 |
accgtcaacgccttttttctta-tataaaataatatcatcaaataattactannnnnnnnnacaaaacaaaatgcaactttgttgtgttagtaa |
339 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32523249 |
accgtcaacgccttttttctttctataaaataatatcatcaaataattacta-ttttttttacaaaacaaaatgcaactttgttgtgttagtaa |
32523341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University