View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_high_31 (Length: 242)
Name: NF11324A_high_31
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 39578548 - 39578753
Alignment:
| Q |
16 |
gaagaatatcacaacattctaccatacatagatcttcatataatcacttgaaaatgaatactgttttactccattattaatcttacaattgagaacagac |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578548 |
gaagaaaatcacaacattctaccatacatagatcttcatataatcacttgaaaatgaatactgttttactccattattaatcttacaattgagaacagac |
39578647 |
T |
 |
| Q |
116 |
caacaaccattaactaaggggcgaaacagggacaaaacagagaagtgagctatctacaaaacagttcatggagacacttgcgtgttgattgttgtccctt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578648 |
caacaaccattaactaaggggggaaacagggacaaaacagagaagtgagctatctacaaaacagttcatggagacacttgcgtgttgattgttgtccctt |
39578747 |
T |
 |
| Q |
216 |
gatttt |
221 |
Q |
| |
|
|||||| |
|
|
| T |
39578748 |
gatttt |
39578753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 138 - 220
Target Start/End: Original strand, 39542302 - 39542384
Alignment:
| Q |
138 |
gaaacagggacaaaacagagaagtgagctatctacaaaacagttcatggagacacttgcgtgttgattgttgtcccttgattt |
220 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||| | ||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39542302 |
gaaacaaggacaaaacagagaaatgaggtattgaaaaaacagctcatggagacacttgcgtgttgattgttgtaccttgattt |
39542384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 39574183 - 39574219
Alignment:
| Q |
184 |
tggagacacttgcgtgttgattgttgtcccttgattt |
220 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
39574183 |
tggagacatttgcgtgttgattgttgtgccttgattt |
39574219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University