View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_104 (Length: 342)
Name: NF11324A_low_104
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_104 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 2 - 318
Target Start/End: Complemental strand, 7753063 - 7752747
Alignment:
| Q |
2 |
ctggttttgaaatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaatgtatatgtagagttgttct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753063 |
ctggttttgaaatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaatgtatatgtagagttgttct |
7752964 |
T |
|
| Q |
102 |
aggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttagtgagtcgacctagtgacgcag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7752963 |
aggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttggtgagtcgacctagtgatgcag |
7752864 |
T |
|
| Q |
202 |
ggatttggccggtaaacctgttcccggagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattgggccggtgagactgtccaagct |
301 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7752863 |
ggatttggccggtaaacctgttcccagagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattgggcctgtgagactgtccaagct |
7752764 |
T |
|
| Q |
302 |
aaagtcgaggtggacaa |
318 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
7752763 |
aaagtcgaggtgaacaa |
7752747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University