View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_160 (Length: 299)
Name: NF11324A_low_160
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_160 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 53308914 - 53309210
Alignment:
| Q |
1 |
aatatcataggtgcatcatcttcaactagttcttcatctttggctaatttttatgccagtaataatnnnnnnnccaagtacaacaaacttcaaacactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53308914 |
aatatcataggtgcatcatcttcaactagttcttcatctttggctaatttctatgccagtaataataaaaaaaccaagtacaacaaacttcaaacactct |
53309013 |
T |
 |
| Q |
101 |
cacatgggcttgagctggatgatgatcttgtctctagtagtgtagttcctgctgtgacagttgtgttggagggccgttcgatctgccaacgcatcagcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309014 |
cacatgggcttgagctggatgatgatcttgtctctagtagtgtagttcctgctgtgacagttgtgttggagggccgttcgatctgccaacgcatcagcct |
53309113 |
T |
 |
| Q |
201 |
tcacaaccacggtagctaccaaagtctggccaaggctctccgccagatgtttgtcgattgcacggatgactgcgacgccggtgatcatcatcttgat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309114 |
tcacaaccacggtagctaccaaagtctggccaaggctctccgccagatgtttgtcgattgcacggatgactgcgacgccggtgatcatcatcttgat |
53309210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University