View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_170 (Length: 294)
Name: NF11324A_low_170
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_170 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 6 - 289
Target Start/End: Original strand, 24210822 - 24211105
Alignment:
| Q |
6 |
gtttggtgttcaatatttcttcaatggataaactctgattacgtggctaaatccaattcgctacatctagcttacctcttctattcaagataattcccac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24210822 |
gtttggtgttcaatatttcttcaatggataaactctgattacgtggctaaatccaattcgctacatctagcttacctcttctattcaagataattcccac |
24210921 |
T |
 |
| Q |
106 |
aaacaccaaactagattaacggtccaaagccaaagataaacattactatgttaatgtttcacaaaccaaaaaacatgttctatagttgaaacaaagagtg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24210922 |
aaacaccaaactagattaacggtccaaagccaaagataaacattactatgtttatgtttcacaaaccaaaaaacatgttctatagttgaaacaaagagtg |
24211021 |
T |
 |
| Q |
206 |
tgaacttgttggaaaatcttaactataaccatccatggttcccactctttcatccaattctttatctcatccaaagttgaattt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211022 |
tgaacttgttggaaaatcttaactataaccatccatggttcccactctttcatccaattctttatctcatccaaagttgaattt |
24211105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University