View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_174 (Length: 290)
Name: NF11324A_low_174
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_174 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 6 - 136
Target Start/End: Complemental strand, 14650249 - 14650124
Alignment:
| Q |
6 |
atttctattatgaatgttcattaaaccatgaacgcatttatgtaannnnnnnnnnnatattttcttattgcagatcaatggagtattctgatgaagacaa |
105 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14650249 |
atttctattatgaatgttcgttaaaccatgaacgcatttatgtaatttttt-----atattttcttattgcagatcaatggagtattatgatgaagacaa |
14650155 |
T |
 |
| Q |
106 |
agactatgatcttgacaatgaggaaagtgac |
136 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
14650154 |
cgactatgatcctgacaatgaggaaagtgac |
14650124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 161 - 242
Target Start/End: Complemental strand, 2344981 - 2344900
Alignment:
| Q |
161 |
tattgattctatcacttatatataattgttcaatctccaatttttagataaataggagacttctaactcacatttgttacaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
2344981 |
tattgattctatcacttatatataattgttcaatctccaatttttagataaataggagacttgtaactcacatttgtcacaa |
2344900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 6 - 136
Target Start/End: Complemental strand, 34208668 - 34208543
Alignment:
| Q |
6 |
atttctattatgaatgttcattaaaccatgaacgcatttatgtaannnnnnnnnnnatattttcttattgcagatcaatggagtattctgatgaagacaa |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34208668 |
atttctattatgaatgtttgttaaaccatgaacgcatttatgtaatttttt-----atattttcttattgcagatcaatggagtattatgatgaagacaa |
34208574 |
T |
 |
| Q |
106 |
agactatgatcttgacaatgaggaaagtgac |
136 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
34208573 |
cgactatgatcctgacaatgaggaaagtgac |
34208543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University