View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_183 (Length: 286)
Name: NF11324A_low_183
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_183 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 53 - 286
Target Start/End: Original strand, 29104767 - 29104987
Alignment:
| Q |
53 |
ggttgaccaacccaaaagtgattatagagagtcggctcaaatttcatccttgatatatcacatctttcagaattacagattttataatctcttagaccac |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104767 |
ggttgaccaacccaaaagtgattatagagagtcggctcaaatttcatccttgatatatcacatctttcagaattacagattttataatctcttagac--- |
29104863 |
T |
|
| Q |
153 |
agttgcagacagatagccacaaaaatcagcttctagaatttgcagaagcttcatgtttcttgaagatcctttccattatcgttcatctttataacttttt |
252 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104864 |
----------agatagccacaaaaatcaggttctagaatttgcagaagtttcatgtttcttgaagatcctttccattatcgttcatctttataacttttt |
29104953 |
T |
|
| Q |
253 |
gcccaccccacttacttatcctttcttccgcaag |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29104954 |
gcccaccccacttacttatcctttcttccgcaag |
29104987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 29104677 - 29104733
Alignment:
| Q |
1 |
aacaatttcagcttttaggtagaattgattccgtgattagaaccaagtttgaggttg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29104677 |
aacaatttcagcttttaggtagaattgattccgtgattagaaccaattttgaggttg |
29104733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University