View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_184 (Length: 286)
Name: NF11324A_low_184
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_184 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 6 - 281
Target Start/End: Original strand, 36506363 - 36506637
Alignment:
| Q |
6 |
agaaacacagaatagaggccgaacaactaacaacaacaaaccctctacgctaactagcaaaatctgagaagctaagaacaaaaaacaccaaaaaccaaac |
105 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36506363 |
agaaaaacagaacagaggccaaacaactaacaacaacaacccctctacgccaactagcaaaatctgagaagctaagaacaaaaaacagcaaaaaccaaac |
36506462 |
T |
|
| Q |
106 |
agcagcacacttatggacacacacttcaatttgataacaagaaatggaaacacgcaagagaaaaatggaattaattgacattttacctgcttgtactcaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36506463 |
agcagcacacttatggacacacacttcaatt-gataacaagaaatggaaacatgcaagagaaaaatggaattaattgatattttacctgcttgtactcaa |
36506561 |
T |
|
| Q |
206 |
ataattccttgtctgagtagtagaattctctttttgtggagtaggaattgtctttcaacaaatctatgatcaaggt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36506562 |
ataattccttgtctgagtagtagaattctctttttgtggagtaggaattgtctttcaacaaatatatgatcaaggt |
36506637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University