View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_200 (Length: 274)
Name: NF11324A_low_200
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_200 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 246
Target Start/End: Complemental strand, 24706865 - 24706633
Alignment:
| Q |
13 |
atcacaatgcaaccacacaaaagacagtgatttgacagcagttaataaacttggttgaaaatttccaaatgttcagtctcgaaccgagtaccacgtggtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24706865 |
atcacaatgcaaccacacaaaagacagtgatttgacagcagttaataaacttggttgaaaatttccaaatgttcagtctcgaaccgagtaccacaaggtt |
24706766 |
T |
|
| Q |
113 |
gaaaagtggtcttacaactaagtgactttgttcggaactttgtagaaagatcagtccatcagttatgttattcgcattattaaaatcactgaatctttgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24706765 |
gaaaagtggtcttacaactaagtgac-ttgttcggaactttgtagaaagatcagtccataagttatgttattcgcattattaaaatcactgtctctttgt |
24706667 |
T |
|
| Q |
213 |
cgttcccctatttttgttatctctattcttccac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24706666 |
cgttcccctatttttgttatctctattcttccac |
24706633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University