View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_203 (Length: 271)
Name: NF11324A_low_203
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_203 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 9231400 - 9231227
Alignment:
| Q |
12 |
atgtgcacgaagttttcaatttctccaaggtaatgaatacgcagtccactgagtggaccccacatgcacattttataatagaaaaatgattaattatttc |
111 |
Q |
| |
|
||||||||||||| |||||||| |||| || |||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231400 |
atgtgcacgaagtattcaatttatccatggaaatgaaagcgcagtccactgaatcgaccccacatgcacattttataatagaaaaatgattaattatttc |
9231301 |
T |
 |
| Q |
112 |
gactgtacaaacttcctaagtattttgtcacaatctgggttctactagtttttatagacccttcttattacttc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231300 |
gactgtacaaacttcctaagtattttgtcacaatctgggttctactagtttttatagacccttcttattacttc |
9231227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 182 - 271
Target Start/End: Complemental strand, 9231174 - 9231084
Alignment:
| Q |
182 |
cttcgataggacagcatagaacannnnnnnaaatagagaagatttgggttttttcacaagtc-tctttaattaaaaaaggtcagaccgtga |
271 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
9231174 |
cttcgataggacaacatacaacatttttttaaatagagaagatttgggtttttacacaagtcttttttaattaaaaaaggtcagaccgtga |
9231084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University