View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_211 (Length: 267)
Name: NF11324A_low_211
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_211 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 11697246 - 11697512
Alignment:
| Q |
1 |
atgttgaaacaaaacaactcaggcgattatttggtgcttgcaaatatatacgcaaaagcacaaaagtgggacgaagtagccaagatcagaacaaaattag |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11697246 |
atgttgaatcaaaacaactcaggcgattatttggtgcttgctaatatgtacgcaaaggcacaaaagtgggacgatgtagccaagatcagaacaaaattag |
11697345 |
T |
|
| Q |
101 |
ccgaaagaaacttggtacaaacacccgggtttagtttaattgaagcaaagaggaaagtgtacaagtttgtttcacaagacaagtctatacctcaatggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697346 |
ccgaaagaaacttggtacaaacacccgggtttagtttaattgaagcaaagaggaaagtgtacaagtttgtttcacaagacaagtctatacctcaatggaa |
11697445 |
T |
|
| Q |
201 |
cataatctatgagatgattcaccaaatggaatggcagttgaaatttgaagggtacataccagataca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697446 |
cataatctatgagatgattcaccaaatggaatggcagttgaaatttgaagggtacataccagataca |
11697512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University